rust/src/test/bench/shootout-fasta.rs

115 lines
4.0 KiB
Rust
Raw Normal View History

/* -*- mode: rust; indent-tabs-mode: nil -*-
* Implementation of 'fasta' benchmark from
* Computer Language Benchmarks Game
* http://shootout.alioth.debian.org/
*/
extern mod std;
2012-09-05 14:32:05 -05:00
use io::WriterUtil;
2012-08-01 19:30:05 -05:00
fn LINE_LENGTH() -> uint { return 60u; }
2012-03-26 20:35:18 -05:00
type myrandom = @{mut last: u32};
fn myrandom_next(r: myrandom, mx: u32) -> u32 {
r.last = (r.last * 3877u32 + 29573u32) % 139968u32;
mx * r.last / 139968u32
}
2011-07-27 07:19:39 -05:00
type aminoacids = {ch: char, prob: u32};
fn make_cumulative(aa: ~[aminoacids]) -> ~[aminoacids] {
let mut cp: u32 = 0u32;
let mut ans: ~[aminoacids] = ~[];
2012-06-30 18:19:07 -05:00
for aa.each |a| { cp += a.prob; ans += ~[{ch: a.ch, prob: cp}]; }
2012-08-01 19:30:05 -05:00
return ans;
}
fn select_random(r: u32, genelist: ~[aminoacids]) -> char {
2012-08-01 19:30:05 -05:00
if r < genelist[0].prob { return genelist[0].ch; }
fn bisect(v: ~[aminoacids], lo: uint, hi: uint, target: u32) -> char {
2011-07-27 07:19:39 -05:00
if hi > lo + 1u {
let mid: uint = lo + (hi - lo) / 2u;
if target < v[mid].prob {
2012-08-01 19:30:05 -05:00
return bisect(v, lo, mid, target);
} else { return bisect(v, mid, hi, target); }
} else { return v[hi].ch; }
}
return bisect(copy genelist, 0, vec::len::<aminoacids>(genelist) - 1, r);
}
2012-08-14 15:38:35 -05:00
fn make_random_fasta(wr: io::Writer, id: ~str, desc: ~str, genelist: ~[aminoacids], n: int) {
wr.write_line(~">" + id + ~" " + desc);
2012-08-27 16:22:25 -05:00
let rng = @{mut last: rand::Rng().next()};
let mut op: ~str = ~"";
2012-06-30 18:19:07 -05:00
for uint::range(0u, n as uint) |_i| {
2012-09-21 20:36:32 -05:00
str::push_char(&mut op, select_random(myrandom_next(rng, 100u32),
genelist));
2012-02-23 03:44:04 -06:00
if str::len(op) >= LINE_LENGTH() {
wr.write_line(op);
op = ~"";
}
}
if str::len(op) > 0u { wr.write_line(op); }
}
2012-08-14 15:38:35 -05:00
fn make_repeat_fasta(wr: io::Writer, id: ~str, desc: ~str, s: ~str, n: int) unsafe {
wr.write_line(~">" + id + ~" " + desc);
let mut op: ~str = ~"";
2012-02-23 03:44:04 -06:00
let sl: uint = str::len(s);
2012-06-30 18:19:07 -05:00
for uint::range(0u, n as uint) |i| {
2012-09-21 20:36:32 -05:00
str::raw::push_byte(&mut op, s[i % sl]);
2012-02-23 03:44:04 -06:00
if str::len(op) >= LINE_LENGTH() {
wr.write_line(op);
op = ~"";
}
}
if str::len(op) > 0u { wr.write_line(op); }
}
2012-08-01 19:30:05 -05:00
fn acid(ch: char, prob: u32) -> aminoacids { return {ch: ch, prob: prob}; }
fn main() {
let args = os::args();
let args = if os::getenv(~"RUST_BENCH").is_some() {
// alioth tests k-nucleotide with this data at 25,000,000
~[~"", ~"5000000"]
} else if args.len() <= 1u {
~[~"", ~"1000"]
} else {
args
};
let writer = if os::getenv(~"RUST_BENCH").is_some() {
2012-09-25 18:23:04 -05:00
result::get(&io::file_writer(&Path("./shootout-fasta.data"),
~[io::Truncate, io::Create]))
} else {
io::stdout()
};
let n = int::from_str(args[1]).get();
let iub: ~[aminoacids] =
make_cumulative(~[acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
acid('H', 2u32), acid('K', 2u32), acid('M', 2u32),
acid('N', 2u32), acid('R', 2u32), acid('S', 2u32),
acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]);
let homosapiens: ~[aminoacids] =
make_cumulative(~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
acid('t', 30u32)]);
let alu: ~str =
~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
~"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
~"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
~"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
~"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
~"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
~"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
make_repeat_fasta(writer, ~"ONE", ~"Homo sapiens alu", alu, n * 2);
make_random_fasta(writer, ~"TWO", ~"IUB ambiguity codes", iub, n * 3);
make_random_fasta(writer, ~"THREE",
~"Homo sapiens frequency", homosapiens, n * 5);
}