Add the Alioth k-nucleotide benchmark
This is not particularly well performing yet (60x slower than C++ or worse). I think the slicing and the copies made for the hashmap are mostly responsible, but YMMV. By default shootout-fasta writes to stdout and shootout-k-nucleotide reads from stdin. To use an intermediate file with a fixed name, set RUST_BENCH...
This commit is contained in:
Kevin Cantu
Brian Anderson
parent
c1859d4cd0
commit
c2a9cc9394
@ -10,6 +10,7 @@ import vec;
|
||||
import uint;
|
||||
import int;
|
||||
import str;
|
||||
import io::writer_util;
|
||||
|
||||
fn LINE_LENGTH() -> uint { ret 60u; }
|
||||
|
||||
@ -42,39 +43,40 @@ fn select_random(r: u32, genelist: [aminoacids]) -> char {
|
||||
ret bisect(genelist, 0u, vec::len::<aminoacids>(genelist) - 1u, r);
|
||||
}
|
||||
|
||||
fn make_random_fasta(id: str, desc: str, genelist: [aminoacids], n: int) {
|
||||
log(debug, ">" + id + " " + desc);
|
||||
fn make_random_fasta(wr: io::writer, id: str, desc: str, genelist: [aminoacids], n: int) {
|
||||
wr.write_line(">" + id + " " + desc);
|
||||
let rng = @{mut last: std::rand::rng().next()};
|
||||
let mut op: str = "";
|
||||
for uint::range(0u, n as uint) {|_i|
|
||||
str::push_char(op, select_random(myrandom_next(rng, 100u32),
|
||||
genelist));
|
||||
if str::len(op) >= LINE_LENGTH() {
|
||||
log(debug, op);
|
||||
wr.write_line(op);
|
||||
op = "";
|
||||
}
|
||||
}
|
||||
if str::len(op) > 0u { log(debug, op); }
|
||||
if str::len(op) > 0u { wr.write_line(op); }
|
||||
}
|
||||
|
||||
fn make_repeat_fasta(id: str, desc: str, s: str, n: int) unsafe {
|
||||
log(debug, ">" + id + " " + desc);
|
||||
fn make_repeat_fasta(wr: io::writer, id: str, desc: str, s: str, n: int) unsafe {
|
||||
wr.write_line(">" + id + " " + desc);
|
||||
let mut op: str = "";
|
||||
let sl: uint = str::len(s);
|
||||
for uint::range(0u, n as uint) {|i|
|
||||
str::unsafe::push_byte(op, s[i % sl]);
|
||||
if str::len(op) >= LINE_LENGTH() {
|
||||
log(debug, op);
|
||||
wr.write_line(op);
|
||||
op = "";
|
||||
}
|
||||
}
|
||||
if str::len(op) > 0u { log(debug, op); }
|
||||
if str::len(op) > 0u { wr.write_line(op); }
|
||||
}
|
||||
|
||||
fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; }
|
||||
|
||||
fn main(args: [str]) {
|
||||
let args = if os::getenv("RUST_BENCH").is_some() {
|
||||
// alioth tests k-nucleotide with this data at 25,000,000
|
||||
["", "300000"]
|
||||
} else if args.len() <= 1u {
|
||||
["", "1000"]
|
||||
@ -82,6 +84,12 @@ fn main(args: [str]) {
|
||||
args
|
||||
};
|
||||
|
||||
let writer = if os::getenv("RUST_BENCH").is_some() {
|
||||
result::get(io::file_writer("./shootout-fasta.data", [io::truncate, io::create]))
|
||||
} else {
|
||||
io::stdout()
|
||||
};
|
||||
|
||||
let n = int::from_str(args[1]).get();
|
||||
|
||||
let iub: [aminoacids] =
|
||||
@ -101,7 +109,8 @@ fn main(args: [str]) {
|
||||
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
|
||||
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
|
||||
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
|
||||
make_repeat_fasta("ONE", "Homo sapiens alu", alu, n * 2);
|
||||
make_random_fasta("TWO", "IUB ambiguity codes", iub, n * 3);
|
||||
make_random_fasta("THREE", "Homo sapiens frequency", homosapiens, n * 5);
|
||||
make_repeat_fasta(writer, "ONE", "Homo sapiens alu", alu, n * 2);
|
||||
make_random_fasta(writer, "TWO", "IUB ambiguity codes", iub, n * 3);
|
||||
make_random_fasta(writer, "THREE",
|
||||
"Homo sapiens frequency", homosapiens, n * 5);
|
||||
}
|
||||
|
||||
187
src/test/bench/shootout-k-nucleotide.rs
Normal file
187
src/test/bench/shootout-k-nucleotide.rs
Normal file
@ -0,0 +1,187 @@
|
||||
// multi tasking k-nucleotide
|
||||
|
||||
import io::reader_util;
|
||||
|
||||
use std;
|
||||
import std::map;
|
||||
import std::map::hashmap;
|
||||
import std::sort;
|
||||
|
||||
// given a map, print a sorted version of it
|
||||
fn sort_and_fmt(mm: hashmap<[u8], uint>, total: uint) -> str {
|
||||
fn pct(xx: uint, yy: uint) -> float {
|
||||
ret (xx as float) * 100f / (yy as float);
|
||||
}
|
||||
|
||||
fn le_by_val<TT: copy, UU: copy>(kv0: (TT,UU), kv1: (TT,UU)) -> bool {
|
||||
let (_, v0) = kv0;
|
||||
let (_, v1) = kv1;
|
||||
ret v0 >= v1;
|
||||
}
|
||||
|
||||
fn le_by_key<TT: copy, UU: copy>(kv0: (TT,UU), kv1: (TT,UU)) -> bool {
|
||||
let (k0, _) = kv0;
|
||||
let (k1, _) = kv1;
|
||||
ret k0 <= k1;
|
||||
}
|
||||
|
||||
// sort by key, then by value
|
||||
fn sortKV<TT: copy, UU: copy>(orig: [(TT,UU)]) -> [(TT,UU)] {
|
||||
ret sort::merge_sort(le_by_val, sort::merge_sort(le_by_key, orig));
|
||||
}
|
||||
|
||||
let mut pairs = [];
|
||||
|
||||
// map -> [(k,%)]
|
||||
mm.each(fn&(key: [u8], val: uint) -> bool {
|
||||
pairs += [(key, pct(val, total))];
|
||||
ret true;
|
||||
});
|
||||
|
||||
let pairs_sorted = sortKV(pairs);
|
||||
|
||||
let mut buffer = "";
|
||||
|
||||
pairs_sorted.each(fn&(kv: ([u8], float)) -> bool unsafe {
|
||||
let (k,v) = kv;
|
||||
buffer += (#fmt["%s %0.3f\n", str::to_upper(str::unsafe::from_bytes(k)), v]);
|
||||
ret true;
|
||||
});
|
||||
|
||||
ret buffer;
|
||||
}
|
||||
|
||||
// given a map, search for the frequency of a pattern
|
||||
fn find(mm: hashmap<[u8], uint>, key: str) -> uint {
|
||||
alt mm.find(str::bytes(str::to_lower(key))) {
|
||||
option::none { ret 0u; }
|
||||
option::some(num) { ret num; }
|
||||
}
|
||||
}
|
||||
|
||||
// given a map, increment the counter for a key
|
||||
fn update_freq(mm: hashmap<[u8], uint>, key: [u8]) {
|
||||
alt mm.find(key) {
|
||||
option::none { mm.insert(key, 1u ); }
|
||||
option::some(val) { mm.insert(key, 1u + val); }
|
||||
}
|
||||
}
|
||||
|
||||
// given a [u8], for each window call a function
|
||||
// i.e., for "hello" and windows of size four,
|
||||
// run it("hell") and it("ello"), then return "llo"
|
||||
fn windows_with_carry(bb: [const u8], nn: uint, it: fn(window: [u8])) -> [u8] {
|
||||
let mut ii = 0u;
|
||||
|
||||
let len = vec::len(bb);
|
||||
while ii < len - (nn - 1u) {
|
||||
it(vec::slice(bb, ii, ii+nn));
|
||||
ii += 1u;
|
||||
}
|
||||
|
||||
ret vec::slice(bb, len - (nn - 1u), len);
|
||||
}
|
||||
|
||||
fn make_sequence_processor(sz: uint, from_parent: comm::port<[u8]>, to_parent: comm::chan<str>) {
|
||||
|
||||
let freqs: hashmap<[u8], uint> = map::bytes_hash();
|
||||
let mut carry: [u8] = [];
|
||||
let mut total: uint = 0u;
|
||||
|
||||
let mut line: [u8];
|
||||
|
||||
loop {
|
||||
|
||||
line = comm::recv(from_parent);
|
||||
if line == [] { break; }
|
||||
|
||||
carry = windows_with_carry(carry + line, sz, { |window|
|
||||
update_freq(freqs, window);
|
||||
total += 1u;
|
||||
});
|
||||
}
|
||||
|
||||
let buffer = alt sz {
|
||||
1u { sort_and_fmt(freqs, total) }
|
||||
2u { sort_and_fmt(freqs, total) }
|
||||
3u { #fmt["%u\t%s", find(freqs, "GGT"), "GGT"] }
|
||||
4u { #fmt["%u\t%s", find(freqs, "GGTA"), "GGTA"] }
|
||||
6u { #fmt["%u\t%s", find(freqs, "GGTATT"), "GGTATT"] }
|
||||
12u { #fmt["%u\t%s", find(freqs, "GGTATTTTAATT"), "GGTATTTTAATT"] }
|
||||
18u { #fmt["%u\t%s", find(freqs, "GGTATTTTAATTTATAGT"), "GGTATTTTAATTTATAGT"] }
|
||||
_ { "" }
|
||||
};
|
||||
|
||||
//comm::send(to_parent, #fmt["yay{%u}", sz]);
|
||||
comm::send(to_parent, buffer);
|
||||
}
|
||||
|
||||
// given a FASTA file on stdin, process sequence THREE
|
||||
fn main(args: [str]) {
|
||||
let rdr = if os::getenv("RUST_BENCH").is_some() {
|
||||
result::get(io::file_reader("./shootout-fasta.data"))
|
||||
} else {
|
||||
io::stdin()
|
||||
};
|
||||
|
||||
|
||||
|
||||
// initialize each sequence sorter
|
||||
let sizes = [1u,2u,3u,4u,6u,12u,18u];
|
||||
let from_child = vec::map (sizes, { |_sz| comm::port() });
|
||||
let to_parent = vec::mapi(sizes, { |ii, _sz| comm::chan(from_child[ii]) });
|
||||
let to_child = vec::mapi(sizes, fn@(ii: uint, sz: uint) -> comm::chan<[u8]> {
|
||||
ret task::spawn_listener { |from_parent|
|
||||
make_sequence_processor(sz, from_parent, to_parent[ii]);
|
||||
};
|
||||
});
|
||||
|
||||
|
||||
// latch stores true after we've started
|
||||
// reading the sequence of interest
|
||||
let mut proc_mode = false;
|
||||
|
||||
while !rdr.eof() {
|
||||
let line: str = rdr.read_line();
|
||||
|
||||
if str::len(line) == 0u { cont; }
|
||||
|
||||
alt (line[0], proc_mode) {
|
||||
|
||||
// start processing if this is the one
|
||||
('>' as u8, false) {
|
||||
alt str::find_str_from(line, "THREE", 1u) {
|
||||
option::some(_) { proc_mode = true; }
|
||||
option::none { }
|
||||
}
|
||||
}
|
||||
|
||||
// break our processing
|
||||
('>' as u8, true) { break; }
|
||||
|
||||
// process the sequence for k-mers
|
||||
(_, true) {
|
||||
let line_bytes = str::bytes(line);
|
||||
|
||||
for sizes.eachi { |ii, _sz|
|
||||
let mut lb = line_bytes;
|
||||
comm::send(to_child[ii], lb);
|
||||
}
|
||||
}
|
||||
|
||||
// whatever
|
||||
_ { }
|
||||
}
|
||||
}
|
||||
|
||||
// finish...
|
||||
for sizes.eachi { |ii, _sz|
|
||||
comm::send(to_child[ii], []);
|
||||
}
|
||||
|
||||
// now fetch and print result messages
|
||||
for sizes.eachi { |ii, _sz|
|
||||
io::println(comm::recv(from_child[ii]));
|
||||
}
|
||||
}
|
||||
|
||||
Loading…
x
Reference in New Issue
Block a user