rust/src/test/bench/shootout-fasta-redux.rs
2014-09-16 14:37:48 -07:00

207 lines
5.9 KiB
Rust

// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
// file at the top-level directory of this distribution and at
// http://rust-lang.org/COPYRIGHT.
//
// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
// option. This file may not be copied, modified, or distributed
// except according to those terms.
use std::cmp::min;
use std::io::{stdout, IoResult};
use std::os;
use std::slice::bytes::copy_memory;
static LINE_LEN: uint = 60;
static LOOKUP_SIZE: uint = 4 * 1024;
static LOOKUP_SCALE: f32 = (LOOKUP_SIZE - 1) as f32;
// Random number generator constants
static IM: u32 = 139968;
static IA: u32 = 3877;
static IC: u32 = 29573;
static ALU: &'static str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG\
GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA\
GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA\
AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT\
CCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAAC\
CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG\
CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
static NULL_AMINO_ACID: AminoAcid = AminoAcid { c: ' ' as u8, p: 0.0 };
static IUB: [AminoAcid, ..15] = [
AminoAcid { c: 'a' as u8, p: 0.27 },
AminoAcid { c: 'c' as u8, p: 0.12 },
AminoAcid { c: 'g' as u8, p: 0.12 },
AminoAcid { c: 't' as u8, p: 0.27 },
AminoAcid { c: 'B' as u8, p: 0.02 },
AminoAcid { c: 'D' as u8, p: 0.02 },
AminoAcid { c: 'H' as u8, p: 0.02 },
AminoAcid { c: 'K' as u8, p: 0.02 },
AminoAcid { c: 'M' as u8, p: 0.02 },
AminoAcid { c: 'N' as u8, p: 0.02 },
AminoAcid { c: 'R' as u8, p: 0.02 },
AminoAcid { c: 'S' as u8, p: 0.02 },
AminoAcid { c: 'V' as u8, p: 0.02 },
AminoAcid { c: 'W' as u8, p: 0.02 },
AminoAcid { c: 'Y' as u8, p: 0.02 },
];
static HOMO_SAPIENS: [AminoAcid, ..4] = [
AminoAcid { c: 'a' as u8, p: 0.3029549426680 },
AminoAcid { c: 'c' as u8, p: 0.1979883004921 },
AminoAcid { c: 'g' as u8, p: 0.1975473066391 },
AminoAcid { c: 't' as u8, p: 0.3015094502008 },
];
// FIXME: Use map().
fn sum_and_scale(a: &'static [AminoAcid]) -> Vec<AminoAcid> {
let mut result = Vec::new();
let mut p = 0f32;
for a_i in a.iter() {
let mut a_i = *a_i;
p += a_i.p;
a_i.p = p * LOOKUP_SCALE;
result.push(a_i);
}
let result_len = result.len();
result.get_mut(result_len - 1).p = LOOKUP_SCALE;
result
}
struct AminoAcid {
c: u8,
p: f32,
}
struct RepeatFasta<'a, W:'a> {
alu: &'static str,
out: &'a mut W
}
impl<'a, W: Writer> RepeatFasta<'a, W> {
fn new(alu: &'static str, w: &'a mut W) -> RepeatFasta<'a, W> {
RepeatFasta { alu: alu, out: w }
}
fn make(&mut self, n: uint) -> IoResult<()> {
let alu_len = self.alu.len();
let mut buf = Vec::from_elem(alu_len + LINE_LEN, 0u8);
let alu: &[u8] = self.alu.as_bytes();
copy_memory(buf.as_mut_slice(), alu);
let buf_len = buf.len();
copy_memory(buf.slice_mut(alu_len, buf_len),
alu.slice_to(LINE_LEN));
let mut pos = 0;
let mut bytes;
let mut n = n;
while n > 0 {
bytes = min(LINE_LEN, n);
try!(self.out.write(buf.slice(pos, pos + bytes)));
try!(self.out.write_u8('\n' as u8));
pos += bytes;
if pos > alu_len {
pos -= alu_len;
}
n -= bytes;
}
Ok(())
}
}
fn make_lookup(a: &[AminoAcid]) -> [AminoAcid, ..LOOKUP_SIZE] {
let mut lookup = [ NULL_AMINO_ACID, ..LOOKUP_SIZE ];
let mut j = 0;
for (i, slot) in lookup.iter_mut().enumerate() {
while a[j].p < (i as f32) {
j += 1;
}
*slot = a[j];
}
lookup
}
struct RandomFasta<'a, W:'a> {
seed: u32,
lookup: [AminoAcid, ..LOOKUP_SIZE],
out: &'a mut W,
}
impl<'a, W: Writer> RandomFasta<'a, W> {
fn new(w: &'a mut W, a: &[AminoAcid]) -> RandomFasta<'a, W> {
RandomFasta {
seed: 42,
out: w,
lookup: make_lookup(a),
}
}
fn rng(&mut self, max: f32) -> f32 {
self.seed = (self.seed * IA + IC) % IM;
max * (self.seed as f32) / (IM as f32)
}
fn nextc(&mut self) -> u8 {
let r = self.rng(1.0);
for a in self.lookup.iter() {
if a.p >= r {
return a.c;
}
}
0
}
fn make(&mut self, n: uint) -> IoResult<()> {
let lines = n / LINE_LEN;
let chars_left = n % LINE_LEN;
let mut buf = [0, ..LINE_LEN + 1];
for _ in range(0, lines) {
for i in range(0u, LINE_LEN) {
buf[i] = self.nextc();
}
buf[LINE_LEN] = '\n' as u8;
try!(self.out.write(buf));
}
for i in range(0u, chars_left) {
buf[i] = self.nextc();
}
self.out.write(buf.slice_to(chars_left))
}
}
fn main() {
let args = os::args();
let args = args.as_slice();
let n = if args.len() > 1 {
from_str::<uint>(args[1].as_slice()).unwrap()
} else {
5
};
let mut out = stdout();
out.write_line(">ONE Homo sapiens alu").unwrap();
{
let mut repeat = RepeatFasta::new(ALU, &mut out);
repeat.make(n * 2).unwrap();
}
out.write_line(">TWO IUB ambiguity codes").unwrap();
let iub = sum_and_scale(IUB);
let mut random = RandomFasta::new(&mut out, iub.as_slice());
random.make(n * 3).unwrap();
random.out.write_line(">THREE Homo sapiens frequency").unwrap();
let homo_sapiens = sum_and_scale(HOMO_SAPIENS);
random.lookup = make_lookup(homo_sapiens.as_slice());
random.make(n * 5).unwrap();
random.out.write_str("\n").unwrap();
}