// The Computer Language Benchmarks Game // http://benchmarksgame.alioth.debian.org/ // // contributed by the Rust Project Developers // Copyright (c) 2012-2014 The Rust Project Developers // // All rights reserved. // // Redistribution and use in source and binary forms, with or without // modification, are permitted provided that the following conditions // are met: // // - Redistributions of source code must retain the above copyright // notice, this list of conditions and the following disclaimer. // // - Redistributions in binary form must reproduce the above copyright // notice, this list of conditions and the following disclaimer in // the documentation and/or other materials provided with the // distribution. // // - Neither the name of "The Computer Language Benchmarks Game" nor // the name of "The Computer Language Shootout Benchmarks" nor the // names of its contributors may be used to endorse or promote // products derived from this software without specific prior // written permission. // // THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS // "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT // LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS // FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE // COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, // INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES // (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR // SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) // HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, // STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) // ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED // OF THE POSSIBILITY OF SUCH DAMAGE. #![feature(old_io, old_path, io, core)] use std::cmp::min; use std::old_io::*; use std::old_io; use std::old_path::Path; use std::num::Float; use std::env; const LINE_LENGTH: usize = 60; const IM: u32 = 139968; struct MyRandom { last: u32 } impl MyRandom { fn new() -> MyRandom { MyRandom { last: 42 } } fn normalize(p: f32) -> u32 {(p * IM as f32).floor() as u32} fn gen(&mut self) -> u32 { self.last = (self.last * 3877 + 29573) % IM; self.last } } struct AAGen<'a> { rng: &'a mut MyRandom, data: Vec<(u32, u8)> } impl<'a> AAGen<'a> { fn new<'b>(rng: &'b mut MyRandom, aa: &[(char, f32)]) -> AAGen<'b> { let mut cum = 0.; let data = aa.iter() .map(|&(ch, p)| { cum += p; (MyRandom::normalize(cum), ch as u8) }) .collect(); AAGen { rng: rng, data: data } } } impl<'a> Iterator for AAGen<'a> { type Item = u8; fn next(&mut self) -> Option { let r = self.rng.gen(); self.data.iter() .skip_while(|pc| pc.0 < r) .map(|&(_, c)| c) .next() } } fn make_fasta>( wr: &mut W, header: &str, mut it: I, mut n: usize) -> std::old_io::IoResult<()> { try!(wr.write(header.as_bytes())); let mut line = [0; LINE_LENGTH + 1]; while n > 0 { let nb = min(LINE_LENGTH, n); for i in 0..nb { line[i] = it.next().unwrap(); } n -= nb; line[nb] = '\n' as u8; try!(wr.write(&line[..nb+1])); } Ok(()) } fn run(writer: &mut W) -> std::old_io::IoResult<()> { let mut args = env::args(); let n = if env::var_os("RUST_BENCH").is_some() { 25000000 } else if args.len() <= 1 { 1000 } else { args.nth(1).unwrap().parse().unwrap() }; let rng = &mut MyRandom::new(); let alu = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; let iub = &[('a', 0.27), ('c', 0.12), ('g', 0.12), ('t', 0.27), ('B', 0.02), ('D', 0.02), ('H', 0.02), ('K', 0.02), ('M', 0.02), ('N', 0.02), ('R', 0.02), ('S', 0.02), ('V', 0.02), ('W', 0.02), ('Y', 0.02)]; let homosapiens = &[('a', 0.3029549426680), ('c', 0.1979883004921), ('g', 0.1975473066391), ('t', 0.3015094502008)]; try!(make_fasta(writer, ">ONE Homo sapiens alu\n", alu.as_bytes().iter().cycle().cloned(), n * 2)); try!(make_fasta(writer, ">TWO IUB ambiguity codes\n", AAGen::new(rng, iub), n * 3)); try!(make_fasta(writer, ">THREE Homo sapiens frequency\n", AAGen::new(rng, homosapiens), n * 5)); writer.flush() } fn main() { let res = if env::var_os("RUST_BENCH").is_some() { let mut file = BufferedWriter::new(File::create(&Path::new("./shootout-fasta.data"))); run(&mut file) } else { run(&mut old_io::stdout()) }; res.unwrap() }