/* -*- mode: rust; indent-tabs-mode: nil -*- * Implementation of 'fasta' benchmark from * Computer Language Benchmarks Game * http://shootout.alioth.debian.org/ */ use std; import std::vec; import std::str; import std::uint; import std::int; fn LINE_LENGTH() -> uint { ret 60u; } obj myrandom(mutable last: u32) { fn next(mx: u32) -> u32 { last = (last * 3877u32 + 29573u32) % 139968u32; let ans = mx * last / 139968u32; ret ans; } } type aminoacids = {ch: char, prob: u32}; fn make_cumulative(aa: &[aminoacids]) -> [aminoacids] { let cp: u32 = 0u32; let ans: [aminoacids] = ~[]; for a: aminoacids in aa { cp += a.prob; ans += ~[{ch: a.ch, prob: cp}]; } ret ans; } fn select_random(r: u32, genelist: &[aminoacids]) -> char { if r < genelist.(0).prob { ret genelist.(0).ch; } fn bisect(v: &[aminoacids], lo: uint, hi: uint, target: u32) -> char { if hi > lo + 1u { let mid: uint = lo + (hi - lo) / 2u; if target < v.(mid).prob { be bisect(v, lo, mid, target); } else { be bisect(v, mid, hi, target); } } else { ret v.(hi).ch; } } ret bisect(genelist, 0u, vec::len::(genelist) - 1u, r); } fn make_random_fasta(id: str, desc: str, genelist: &[aminoacids], n: int) { log ">" + id + " " + desc; let rng = myrandom(std::rand::mk_rng().next()); let op: str = ""; for each i: uint in uint::range(0u, n as uint) { str::push_byte(op, select_random(rng.next(100u32), genelist) as u8); if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; } } if str::byte_len(op) > 0u { log op; } } fn make_repeat_fasta(id: str, desc: str, s: str, n: int) { log ">" + id + " " + desc; let op: str = ""; let sl: uint = str::byte_len(s); for each i: uint in uint::range(0u, n as uint) { str::push_byte(op, s.(i % sl)); if str::byte_len(op) >= LINE_LENGTH() { log op; op = ""; } } if str::byte_len(op) > 0u { log op; } } fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; } fn main(args: [str]) { let iub: [aminoacids] = make_cumulative( ~[acid('a', 27u32), acid('c', 12u32), acid('g', 12u32), acid('t', 27u32), acid('B', 2u32), acid('D', 2u32), acid('H', 2u32), acid('K', 2u32), acid('M', 2u32), acid('N', 2u32), acid('R', 2u32), acid('S', 2u32), acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]); let homosapiens: [aminoacids] = make_cumulative( ~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32), acid('t', 30u32)]); let alu: str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; let n: int = 512; make_repeat_fasta("ONE", "Homo sapiens alu", alu, n * 2); make_random_fasta("TWO", "IUB ambiguity codes", iub, n * 3); make_random_fasta("THREE", "Homo sapiens frequency", homosapiens, n * 5); }