// Copyright 2012-2013 The Rust Project Developers. See the COPYRIGHT // file at the top-level directory of this distribution and at // http://rust-lang.org/COPYRIGHT. // // Licensed under the Apache License, Version 2.0 or the MIT license // , at your // option. This file may not be copied, modified, or distributed // except according to those terms. /* -*- mode: rust; indent-tabs-mode: nil -*- * Implementation of 'fasta' benchmark from * Computer Language Benchmarks Game * http://shootout.alioth.debian.org/ */ extern mod extra; use std::int; use std::io; use std::os; use std::rand::Rng; use std::rand; use std::result; use std::str; use std::uint; static LINE_LENGTH: uint = 60u; struct MyRandom { last: u32 } fn myrandom_next(r: @mut MyRandom, mx: u32) -> u32 { r.last = (r.last * 3877u32 + 29573u32) % 139968u32; mx * r.last / 139968u32 } #[deriving(Clone)] struct AminoAcids { ch: char, prob: u32 } fn make_cumulative(aa: ~[AminoAcids]) -> ~[AminoAcids] { let mut cp: u32 = 0u32; let mut ans: ~[AminoAcids] = ~[]; for aa.iter().advance |a| { cp += a.prob; ans.push(AminoAcids {ch: a.ch, prob: cp}); } ans } fn select_random(r: u32, genelist: ~[AminoAcids]) -> char { if r < genelist[0].prob { return genelist[0].ch; } fn bisect(v: ~[AminoAcids], lo: uint, hi: uint, target: u32) -> char { if hi > lo + 1u { let mid: uint = lo + (hi - lo) / 2u; if target < v[mid].prob { return bisect(v, lo, mid, target); } else { return bisect(v, mid, hi, target); } } else { return v[hi].ch; } } bisect(genelist.clone(), 0, genelist.len() - 1, r) } fn make_random_fasta(wr: @io::Writer, id: ~str, desc: ~str, genelist: ~[AminoAcids], n: int) { wr.write_line(~">" + id + " " + desc); let mut rng = rand::rng(); let rng = @mut MyRandom { last: rng.next() }; let mut op: ~str = ~""; for uint::range(0u, n as uint) |_i| { op.push_char(select_random(myrandom_next(rng, 100u32), genelist.clone())); if op.len() >= LINE_LENGTH { wr.write_line(op); op = ~""; } } if op.len() > 0u { wr.write_line(op); } } fn make_repeat_fasta(wr: @io::Writer, id: ~str, desc: ~str, s: ~str, n: int) { wr.write_line(~">" + id + " " + desc); let mut op = str::with_capacity( LINE_LENGTH ); let sl = s.len(); for uint::range(0u, n as uint) |i| { if (op.len() >= LINE_LENGTH) { wr.write_line( op ); op = str::with_capacity( LINE_LENGTH ); } op.push_char( s[i % sl] as char ); } if op.len() > 0 { wr.write_line(op) } } fn acid(ch: char, prob: u32) -> AminoAcids { AminoAcids {ch: ch, prob: prob} } fn main() { let args = os::args(); let args = if os::getenv("RUST_BENCH").is_some() { // alioth tests k-nucleotide with this data at 25,000,000 ~[~"", ~"5000000"] } else if args.len() <= 1u { ~[~"", ~"1000"] } else { args }; let writer = if os::getenv("RUST_BENCH").is_some() { io::file_writer(&Path("./shootout-fasta.data"), [io::Truncate, io::Create]).unwrap() } else { io::stdout() }; let n = int::from_str(args[1]).get(); let iub: ~[AminoAcids] = make_cumulative(~[acid('a', 27u32), acid('c', 12u32), acid('g', 12u32), acid('t', 27u32), acid('B', 2u32), acid('D', 2u32), acid('H', 2u32), acid('K', 2u32), acid('M', 2u32), acid('N', 2u32), acid('R', 2u32), acid('S', 2u32), acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]); let homosapiens: ~[AminoAcids] = make_cumulative(~[acid('a', 30u32), acid('c', 20u32), acid('g', 20u32), acid('t', 30u32)]); let alu: ~str = ~"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; make_repeat_fasta(writer, ~"ONE", ~"Homo sapiens alu", alu, n * 2); make_random_fasta(writer, ~"TWO", ~"IUB ambiguity codes", iub, n * 3); make_random_fasta(writer, ~"THREE", ~"Homo sapiens frequency", homosapiens, n * 5); }