/* -*- mode: rust; indent-tabs-mode: nil -*- * Implementation of 'fasta' benchmark from * Computer Language Benchmarks Game * http://shootout.alioth.debian.org/ */ use std; import vec; import uint; import int; import str; fn LINE_LENGTH() -> uint { ret 60u; } type myrandom = @{mutable last: u32}; fn myrandom_next(r: myrandom, mx: u32) -> u32 { r.last = (r.last * 3877u32 + 29573u32) % 139968u32; mx * r.last / 139968u32 } type aminoacids = {ch: char, prob: u32}; fn make_cumulative(aa: [aminoacids]) -> [aminoacids] { let mut cp: u32 = 0u32; let mut ans: [aminoacids] = []; for a: aminoacids in aa { cp += a.prob; ans += [{ch: a.ch, prob: cp}]; } ret ans; } fn select_random(r: u32, genelist: [aminoacids]) -> char { if r < genelist[0].prob { ret genelist[0].ch; } fn bisect(v: [aminoacids], lo: uint, hi: uint, target: u32) -> char { if hi > lo + 1u { let mid: uint = lo + (hi - lo) / 2u; if target < v[mid].prob { be bisect(v, lo, mid, target); } else { be bisect(v, mid, hi, target); } } else { ret v[hi].ch; } } ret bisect(genelist, 0u, vec::len::(genelist) - 1u, r); } fn make_random_fasta(id: str, desc: str, genelist: [aminoacids], n: int) { log(debug, ">" + id + " " + desc); let rng = @{mutable last: std::rand::rng().next()}; let mut op: str = ""; uint::range(0u, n as uint) {|_i| str::push_char(op, select_random(myrandom_next(rng, 100u32), genelist)); if str::len(op) >= LINE_LENGTH() { log(debug, op); op = ""; } } if str::len(op) > 0u { log(debug, op); } } fn make_repeat_fasta(id: str, desc: str, s: str, n: int) unsafe { log(debug, ">" + id + " " + desc); let mut op: str = ""; let sl: uint = str::len(s); uint::range(0u, n as uint) {|i| str::unsafe::push_byte(op, s[i % sl]); if str::len(op) >= LINE_LENGTH() { log(debug, op); op = ""; } } if str::len(op) > 0u { log(debug, op); } } fn acid(ch: char, prob: u32) -> aminoacids { ret {ch: ch, prob: prob}; } fn main() { let iub: [aminoacids] = make_cumulative([acid('a', 27u32), acid('c', 12u32), acid('g', 12u32), acid('t', 27u32), acid('B', 2u32), acid('D', 2u32), acid('H', 2u32), acid('K', 2u32), acid('M', 2u32), acid('N', 2u32), acid('R', 2u32), acid('S', 2u32), acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]); let homosapiens: [aminoacids] = make_cumulative([acid('a', 30u32), acid('c', 20u32), acid('g', 20u32), acid('t', 30u32)]); let alu: str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; let n: int = 512; make_repeat_fasta("ONE", "Homo sapiens alu", alu, n * 2); make_random_fasta("TWO", "IUB ambiguity codes", iub, n * 3); make_random_fasta("THREE", "Homo sapiens frequency", homosapiens, n * 5); }