rust/src/test/bench/shootout/fasta.rs

// xfail-stage0
// xfail-stage1
// xfail-stage2
/* -*- mode: rust; indent-tabs-mode: nil -*-
 * Implementation of 'fasta' benchmark from
 * Computer Language Benchmarks Game
 * http://shootout.alioth.debian.org/
 */
use std;
import std::_vec;
import std::_str;
import std::_uint;
import std::_int;

fn LINE_LENGTH() -> uint {
  ret 60u;
}

obj myrandom(mutable u32 last) {
  fn next(u32 mx) -> u32 {
    last = (last * 3877u32 + 29573u32) % 139968u32;
    auto ans = (mx*last) / 139968u32;
    ret ans;
  }
}

type aminoacids = tup(char, u32);

fn make_cumulative(vec[aminoacids] aa) -> vec[aminoacids] {
  let u32 cp = 0u32;
  let vec[aminoacids] ans = [];
  for (aminoacids a in aa) {
    cp += a._1;
    ans += [tup(a._0, cp)];
  }
  ret ans;
}

fn select_random(u32 r, vec[aminoacids] genelist) -> char {
  if (r < genelist.(0)._1) {
    ret genelist.(0)._0;
  }
  fn bisect(vec[aminoacids] v, uint lo, uint hi, u32 target) -> char {
    if (hi > (lo + 1u)) {
      let uint mid = lo + (hi - lo) / 2u;
      if (target < v.(mid)._1) {
        be bisect(v, lo, mid, target);
      }
      else {
        be bisect(v, mid, hi, target);
      }
    }
    else {
      ret v.(hi)._0;
    }
  }
  ret bisect(genelist, 0u, _vec::len[aminoacids](genelist) - 1u, r);
}

fn make_random_fasta(str id, str desc, vec[aminoacids] genelist, int n) {
  log(">" + id + " " + desc);
  auto rng = myrandom(std::rand::mk_rng().next());
  let str op = "";
  for each (uint i in _uint::range(0u, n as uint)) {
    _str::push_byte(op, select_random(rng.next(100u32), genelist) as u8);
    if (_str::byte_len(op) >= LINE_LENGTH()) {
      log(op);
      op = "";
    }
  }
  if (_str::byte_len(op) > 0u) {
    log(op);
  }
}

fn make_repeat_fasta(str id, str desc, str s, int n) {
  log(">" + id + " " + desc);
  let str op = "";
  let uint sl = _str::byte_len(s);
  for each (uint i in _uint::range(0u, n as uint)) {

    _str::push_byte(op, s.(i % sl));
    if (_str::byte_len(op) >= LINE_LENGTH()) {
      log(op);
      op = "";
    }
  }
  if (_str::byte_len(op) > 0u) {
    log(op);
  }
}

fn main(vec[str] args) {
  let vec[aminoacids] iub = make_cumulative([tup( 'a', 27u32 ),
                                                tup( 'c', 12u32 ),
                                                tup( 'g', 12u32 ),
                                                tup( 't', 27u32 ),

                                                tup( 'B', 2u32 ),
                                                tup( 'D', 2u32 ),
                                                tup( 'H', 2u32 ),
                                                tup( 'K', 2u32 ),
                                                tup( 'M', 2u32 ),
                                                tup( 'N', 2u32 ),
                                                tup( 'R', 2u32 ),
                                                tup( 'S', 2u32 ),
                                                tup( 'V', 2u32 ),
                                                tup( 'W', 2u32 ),
                                                tup( 'Y', 2u32 )]);

  let vec[aminoacids] homosapiens = make_cumulative([tup( 'a', 30u32 ),
                                                        tup( 'c', 20u32 ),
                                                        tup( 'g', 20u32 ),
                                                        tup( 't', 30u32 )]);

  let str alu =
    "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
    "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
    "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
    "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
    "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
    "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
    "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";

  let int n = 512;

  make_repeat_fasta ("ONE", "Homo sapiens alu", alu, n*2);
  make_random_fasta("TWO", "IUB ambiguity codes", iub, n*3);
  make_random_fasta ("THREE", "Homo sapiens frequency", homosapiens, n*5);
}